Sequence retrieval

Genome: Brachyspira hyodysenteriae WA1
Start position: 2198990
End position: 2199016
Length: 27

DNA sequence
>NC_012225, from 2198990 to 2199016 (27 bp); Brachyspira hyodysenteriae WA1 TTAGCTTTTTTAGCTTCTATAGCTTTT
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 2198987-2200006	Sequence	BHWA1_01909 etfA electron transfer flavoprotein subunit alpha (Protein is coded in complementary strand; from 2200006 to 2198987)