Sequence retrieval

Genome: Brachyspira hyodysenteriae WA1
Start position: 2161618
End position: 2161642
Length: 25

DNA sequence
>NC_012225, from 2161618 to 2161642 (25 bp); Brachyspira hyodysenteriae WA1 TTTTATTCTATTATATTTTTTTATA
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 2160689-2161798	Sequence	BHWA1_01875 - glycoslytransferase (Protein is coded in complementary strand; from 2161798 to 2160689)