Sequence retrieval

Genome: Brachyspira hyodysenteriae WA1
Start position: 1958960
End position: 1958983
Length: 24

DNA sequence
>NC_012225, from 1958960 to 1958983 (24 bp); Brachyspira hyodysenteriae WA1 AAAATAAAATTATAAATAAAAATG
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 1958035-1960602	Sequence	BHWA1_01694 - hypothetical protein (Protein is coded in complementary strand; from 1960602 to 1958035)