Sequence retrieval

Genome: Brachyspira hyodysenteriae WA1
Start position: 1939989
End position: 1940042
Length: 54

DNA sequence
>NC_012225, from 1939989 to 1940042 (54 bp); Brachyspira hyodysenteriae WA1 TCGTCATAATCATCTTCATCGTCATAATCATCGTCGTAGTCATCATCATCGTCA
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 1939974-1940381	Sequence	BHWA1_01678 - hypothetical protein (Protein is coded in complementary strand; from 1940381 to 1939974)