Sequence retrieval

Genome: Brachyspira hyodysenteriae WA1
Start position: 1813051
End position: 1813074
Length: 24

DNA sequence
>NC_012225, from 1813051 to 1813074 (24 bp); Brachyspira hyodysenteriae WA1 TATTATTATCATTGTTATTATTTT
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 1812993-1815365	Sequence	BHWA1_01579 - penicillin binding protein (Protein is coded in complementary strand; from 1815365 to 1812993)