Sequence retrieval

Genome: Brachyspira hyodysenteriae WA1
Start position: 1796571
End position: 1796594
Length: 24

DNA sequence
>NC_012225, from 1796571 to 1796594 (24 bp); Brachyspira hyodysenteriae WA1 ATTTTTATTTGTATTATTATTTTG
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 1794988-1796781	Sequence	BHWA1_01558 - glycosyltransferase (Protein is coded in complementary strand; from 1796781 to 1794988)