Sequence retrieval

Genome: Brachyspira hyodysenteriae WA1
Start position: 176156
End position: 176179
Length: 24

DNA sequence
>NC_012225, from 176156 to 176179 (24 bp); Brachyspira hyodysenteriae WA1 TTCTTCTTCTTCGTCTTCTTCTTC
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 176142-176846	Sequence	BHWA1_00155 - hypothetical protein (Protein is coded in complementary strand; from 176846 to 176142)