Sequence retrieval

Genome: Brachyspira hyodysenteriae WA1
Start position: 1756249
End position: 1756278
Length: 30

DNA sequence
>NC_012225, from 1756249 to 1756278 (30 bp); Brachyspira hyodysenteriae WA1 ATTATTATTAATGTTATTATTTTTATTATT
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 1755098-1756333	Sequence	BHWA1_01521 - hypothetical protein (Protein is coded in complementary strand; from 1756333 to 1755098)