Sequence retrieval

Genome: Brachyspira hyodysenteriae WA1
Start position: 1646259
End position: 1646285
Length: 27

DNA sequence
>NC_012225, from 1646259 to 1646285 (27 bp); Brachyspira hyodysenteriae WA1 TTTCCTTAGTTTCCTTATTTTCTTTAG
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 1646237-1648711	Sequence	BHWA1_01429 - metal-dependent phosphohydrolase (Protein is coded in complementary strand; from 1648711 to 1646237)