Sequence retrieval

Genome: Brachyspira hyodysenteriae WA1
Start position: 1641208
End position: 1641243
Length: 36

DNA sequence
>NC_012225, from 1641208 to 1641243 (36 bp); Brachyspira hyodysenteriae WA1 TTTTTATTTATATATTTATTATTATTTTTCTTTTTC
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 1640362-1641261	Sequence	BHWA1_01423 pep Peptidase (Protein is coded in complementary strand; from 1641261 to 1640362)