Sequence retrieval

Genome: Brachyspira hyodysenteriae WA1
Start position: 154862
End position: 154885
Length: 24

DNA sequence
>NC_012225, from 154862 to 154885 (24 bp); Brachyspira hyodysenteriae WA1 TTCAAATTAAAATTCTAATTTAAA
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF.. 153036-154880	Sequence	BHWA1_00135 mcpB methyl-accepting chemotaxis protein McpB