Sequence retrieval

Genome: Brachyspira hyodysenteriae WA1
Start position: 1422646
End position: 1422670
Length: 25

DNA sequence
>NC_012225, from 1422646 to 1422670 (25 bp); Brachyspira hyodysenteriae WA1 TTTTTATTTTTTTTATTTGTTTCTT
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 1421737-1423104	Sequence	BHWA1_01233 - hypothetical protein (Protein is coded in complementary strand; from 1423104 to 1421737)