Sequence retrieval

Genome: Brachyspira hyodysenteriae WA1
Start position: 1368722
End position: 1368766
Length: 45

DNA sequence
>NC_012225, from 1368722 to 1368766 (45 bp); Brachyspira hyodysenteriae WA1 CTTGTTTTTTTAGCAGGTGCTTTTTTAGCAGTAGCTTTTTTAGCA
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 1368713-1371700	Sequence	BHWA1_01187 ppsA2 pyruvate phosphate dikinase (Protein is coded in complementary strand; from 1371700 to 1368713)