Sequence retrieval

Genome: Brachyspira hyodysenteriae WA1
Start position: 1365294
End position: 1365317
Length: 24

DNA sequence
>NC_012225, from 1365294 to 1365317 (24 bp); Brachyspira hyodysenteriae WA1 CAAAATCTAAATCATAATCATAAT
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 1365119-1366123	Sequence	BHWA1_01184 - choloylglycine hydrolase (Protein is coded in complementary strand; from 1366123 to 1365119)