Sequence retrieval

Genome: Brachyspira hyodysenteriae WA1
Start position: 1344727
End position: 1344750
Length: 24

DNA sequence
>NC_012225, from 1344727 to 1344750 (24 bp); Brachyspira hyodysenteriae WA1 AAAAGACAAAGAAAAAGTAAAAGA
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 1344390-1345457	Sequence	BHWA1_01163 ispG 4-hydroxy-3-methylbut-2-en-1-yl diphosphate synthase