Sequence retrieval

Genome: Brachyspira hyodysenteriae WA1
Start position: 1318801
End position: 1318824
Length: 24

DNA sequence
>NC_012225, from 1318801 to 1318824 (24 bp); Brachyspira hyodysenteriae WA1 TATAAATATTAATATAATTGTAAA
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 1318364-1318954	Sequence	BHWA1_01141 - PAP2 family protein (Protein is coded in complementary strand; from 1318954 to 1318364)