Sequence retrieval

Genome: Brachyspira hyodysenteriae WA1
Start position: 1315576
End position: 1315605
Length: 30

DNA sequence
>NC_012225, from 1315576 to 1315605 (30 bp); Brachyspira hyodysenteriae WA1 TTTGATAATTTTTCATAATCTTTCATAAAT
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF.. 1314979-1315602	Sequence	BHWA1_01138 - type 11 methyltransferase (Protein is coded in complementary strand; from 1315602 to 1314979)