Sequence retrieval

Genome: Brachyspira hyodysenteriae WA1
Start position: 1307040
End position: 1307075
Length: 36

DNA sequence
>NC_012225, from 1307040 to 1307075 (36 bp); Brachyspira hyodysenteriae WA1 TTCTATACCTTCTTTAATACCTTCCTCTTTACCTTC
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 1306936-1307814	Sequence	BHWA1_01131 - hypothetical protein (Protein is coded in complementary strand; from 1307814 to 1306936)