Sequence retrieval

Genome: Brachyspira hyodysenteriae WA1
Start position: 1231533
End position: 1231562
Length: 30

DNA sequence
>NC_012225, from 1231533 to 1231562 (30 bp); Brachyspira hyodysenteriae WA1 TTTTTATAAATTTATATCAATTTTTATATT
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF... 1231562-1232980	Sequence	BHWA1_01052 tmpB outer membrane protein (Protein is coded in complementary strand; from 1232980 to 1231562)