Sequence retrieval

Genome: Brachyspira hyodysenteriae WA1
Start position: 1198149
End position: 1198172
Length: 24

DNA sequence
>NC_012225, from 1198149 to 1198172 (24 bp); Brachyspira hyodysenteriae WA1 TTTATCTTTATATTCATCTTTTTC
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 1196521-1198536	Sequence	BHWA1_01021 - hypothetical protein (Protein is coded in complementary strand; from 1198536 to 1196521)