Sequence retrieval

Genome: Brachyspira hyodysenteriae WA1
Start position: 1176309
End position: 1176338
Length: 30

DNA sequence
>NC_012225, from 1176309 to 1176338 (30 bp); Brachyspira hyodysenteriae WA1 AAATTAATAAAAGTAAATAAAAAATAATAT
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF.. 1172593-1176336	Sequence	BHWA1_01006 mfd transcription-repair coupling factor