Sequence retrieval

Genome: Brachyspira hyodysenteriae WA1
Start position: 1085094
End position: 1085120
Length: 27

DNA sequence
>NC_012225, from 1085094 to 1085120 (27 bp); Brachyspira hyodysenteriae WA1 ATTATTTTCAGTATTTTCATTACTTTC
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 1085065-1086042	Sequence	BHWA1_00925 scpA puttative segregation and condensation protein A (Protein is coded in complementary strand; from 1086042 to 1085065)