Sequence retrieval

Genome: Brachyspira hyodysenteriae WA1
Start position: 1022223
End position: 1022246
Length: 24

DNA sequence
>NC_012225, from 1022223 to 1022246 (24 bp); Brachyspira hyodysenteriae WA1 CTTCTGCTTCTTCATCTGCTTTTG
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 1021776-1022747	Sequence	BHWA1_00867 bitA periplasmic-iron-binding protein BitA