Sequence retrieval

Genome: Brachyspira hyodysenteriae WA1
Start position: 1021080
End position: 1021103
Length: 24

DNA sequence
>NC_012225, from 1021080 to 1021103 (24 bp); Brachyspira hyodysenteriae WA1 CTTCTGCTTCTTCATCTGCTTTTG
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 1020630-1021604	Sequence	BHWA1_00866 bitB periplasmic-iron-binding protein BitB