Sequence retrieval

Genome: Brachyspira hyodysenteriae WA1
Start position: 1020294
End position: 1020320
Length: 27

DNA sequence
>NC_012225, from 1020294 to 1020320 (27 bp); Brachyspira hyodysenteriae WA1 TTTTTATCTTTTTTATCTTTTTTATCT
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 1018785-1020338	Sequence	BHWA1_00865 - hypothetical protein (Protein is coded in complementary strand; from 1020338 to 1018785)