Sequence retrieval

Genome: Chloroflexus sp. Y-400-fl
Start position: 999709
End position: 999768
Length: 60

DNA sequence
>NC_012032, from 999709 to 999768 (60 bp); Chloroflexus sp. Y-400-fl AAAGTAGGAGATAGGAAAGTAGGAGATAGGAAAGTAGGAGATAGGAAAGTAGGAGATAGG
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 999642-999860	Sequence	Chy400_0792 - hypothetical protein (Protein is coded in complementary strand; from 999860 to 999642)