Sequence retrieval

Genome: Escherichia coli LF82
Start position: 76043
End position: 76066
Length: 24

DNA sequence
>NC_011993, from 76043 to 76066 (24 bp); Escherichia coli LF82 GCAGCAACAGCAGCAGCGCCAGCA
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 75343-76953	Sequence	LF82_2256 thiP Thiamine transport system permease protein thiP (Protein is coded in complementary strand; from 76953 to 75343)