Sequence retrieval

Genome: Escherichia coli LF82
Start position: 542826
End position: 542849
Length: 24

DNA sequence
>NC_011993, from 542826 to 542849 (24 bp); Escherichia coli LF82 ATATCAATACCAATATCCATTTCA
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 542547-543782	Sequence	LF82_0070 allC allantoate amidohydrolase (Protein is coded in complementary strand; from 543782 to 542547)