Sequence retrieval

Genome: Escherichia coli LF82
Start position: 4164762
End position: 4164785
Length: 24

DNA sequence
>NC_011993, from 4164762 to 4164785 (24 bp); Escherichia coli LF82 AATGCCAATGGCGATGCCAATTCC
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 4164055-4165089	Sequence	LF82_1870 rhaT L-rhamnose-proton symporter (Protein is coded in complementary strand; from 4165089 to 4164055)