Sequence retrieval

Genome: Escherichia coli LF82
Start position: 3774990
End position: 3775016
Length: 27

DNA sequence
>NC_011993, from 3774990 to 3775016 (27 bp); Escherichia coli LF82 AGCGCCATAAGCACCATAAGCGCCATT
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 3774735-3775043	Sequence	LF82_553 - lipoprotein ysaB (Protein is coded in complementary strand; from 3775043 to 3774735)