Sequence retrieval

Genome: Escherichia coli LF82
Start position: 2125284
End position: 2125310
Length: 27

DNA sequence
>NC_011993, from 2125284 to 2125310 (27 bp); Escherichia coli LF82 TAATCTTAGTAATCTTACTAATCTTTG
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF... 2125302-2126207	Sequence	LF82_353 - glycosyl transferase in colanic acid biosynthesis (Protein is coded in complementary strand; from 2126207 to 2125302)