Sequence retrieval

Genome: Escherichia coli LF82
Start position: 1864720
End position: 1864743
Length: 24

DNA sequence
>NC_011993, from 1864720 to 1864743 (24 bp); Escherichia coli LF82 CGGGATCGGCATCGGCATCGGGTT
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 1863995-1865551	Sequence	LF82_3595 yoae hypothetical protein (Protein is coded in complementary strand; from 1865551 to 1863995)