Sequence retrieval

Genome: Thioalkalivibrio sp. HL-EbGR7
Start position: 810148
End position: 810174
Length: 27

DNA sequence
>NC_011901, from 810148 to 810174 (27 bp); Thioalkalivibrio sp. HL-EbGR7 CGGTGGCGCCGGTGGTGCCGGTGCCGC
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 809004-810389	Sequence	Tgr7_0755 - oxidoreductase, FAD-binding (Protein is coded in complementary strand; from 810389 to 809004)