Sequence retrieval

Genome: Thioalkalivibrio sp. HL-EbGR7
Start position: 756181
End position: 756204
Length: 24

DNA sequence
>NC_011901, from 756181 to 756204 (24 bp); Thioalkalivibrio sp. HL-EbGR7 CCGGCGCCGACGGCGGCGGCGGCG
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 755899-756879	Sequence	Tgr7_0700 - transcriptional regulator (Protein is coded in complementary strand; from 756879 to 755899)