Sequence retrieval

Genome: Thioalkalivibrio sp. HL-EbGR7
Start position: 708701
End position: 708728
Length: 28

DNA sequence
>NC_011901, from 708701 to 708728 (28 bp); Thioalkalivibrio sp. HL-EbGR7 AAGGATGAAGGGTGAAGGGTGAAGGGTG
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF.. 707148-708716	Sequence	Tgr7_0656 - Nitrilase/cyanide hydratase and apolipoprotein N-acyltransferase