Sequence retrieval

Genome: Thioalkalivibrio sp. HL-EbGR7
Start position: 546135
End position: 546158
Length: 24

DNA sequence
>NC_011901, from 546135 to 546158 (24 bp); Thioalkalivibrio sp. HL-EbGR7 GCAGGCGCTGGCCCAGGCGAAGGC
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 545996-547450	Sequence	Tgr7_0516 gatA aspartyl/glutamyl-tRNA amidotransferase subunit A