Sequence retrieval

Genome: Thioalkalivibrio sp. HL-EbGR7
Start position: 535020
End position: 535049
Length: 30

DNA sequence
>NC_011901, from 535020 to 535049 (30 bp); Thioalkalivibrio sp. HL-EbGR7 TTCATTCGCGTTCATTCGCGTTCATTTGCG
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF... 535042-535506	Sequence	Tgr7_0500 - hypothetical protein (Protein is coded in complementary strand; from 535506 to 535042)