Sequence retrieval

Genome: Thioalkalivibrio sp. HL-EbGR7
Start position: 470392
End position: 470415
Length: 24

DNA sequence
>NC_011901, from 470392 to 470415 (24 bp); Thioalkalivibrio sp. HL-EbGR7 CCGGGTGCGGGTGCGGGTCCAGGT
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 468878-470557	Sequence	Tgr7_0444 - hypothetical protein (Protein is coded in complementary strand; from 470557 to 468878)