Sequence retrieval

Genome: Thioalkalivibrio sp. HL-EbGR7
Start position: 410337
End position: 410371
Length: 35

DNA sequence
>NC_011901, from 410337 to 410371 (35 bp); Thioalkalivibrio sp. HL-EbGR7 GCAAGTGGCTAGTGGCTAGTGGCTAGTGGCTAGTG
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF.. 409495-410337	Sequence	Tgr7_0364 - hypothetical protein (Protein is coded in complementary strand; from 410337 to 409495)