Sequence retrieval

Genome: Thioalkalivibrio sp. HL-EbGR7
Start position: 362205
End position: 362228
Length: 24

DNA sequence
>NC_011901, from 362205 to 362228 (24 bp); Thioalkalivibrio sp. HL-EbGR7 GTGGCGGTGCCGATGGCGGTGGCG
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 361737-362711	Sequence	Tgr7_0320 - hypothetical protein (Protein is coded in complementary strand; from 362711 to 361737)