Sequence retrieval

Genome: Thioalkalivibrio sp. HL-EbGR7
Start position: 3419439
End position: 3419466
Length: 28

DNA sequence
>NC_011901, from 3419439 to 3419466 (28 bp); Thioalkalivibrio sp. HL-EbGR7 AAGTGGCAAGTGGCAAGTGGCAAGTGGC
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF.. 3419014-3419448	Sequence	Tgr7_3266 - MshA pilin protein MshD (Protein is coded in complementary strand; from 3419448 to 3419014)