Sequence retrieval

Genome: Thioalkalivibrio sp. HL-EbGR7
Start position: 312780
End position: 312807
Length: 28

DNA sequence
>NC_011901, from 312780 to 312807 (28 bp); Thioalkalivibrio sp. HL-EbGR7 AGTGGCAAGTAGCAAGTGGCTGGTGGCA
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF.. 311197-312792	Sequence	Tgr7_0277 - hypothetical protein
ORF... 312796-313173	Sequence	Tgr7_0278 - hypothetical protein