Sequence retrieval

Genome: Thioalkalivibrio sp. HL-EbGR7
Start position: 3126870
End position: 3126899
Length: 30

DNA sequence
>NC_011901, from 3126870 to 3126899 (30 bp); Thioalkalivibrio sp. HL-EbGR7 TCCATTTGCGTTCATTCGCGTTCATTCGCG
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF... 3126882-3127499	Sequence	Tgr7_2985 - methyltransferase (Protein is coded in complementary strand; from 3127499 to 3126882)