Sequence retrieval

Genome: Thioalkalivibrio sp. HL-EbGR7
Start position: 3070566
End position: 3070600
Length: 35

DNA sequence
>NC_011901, from 3070566 to 3070600 (35 bp); Thioalkalivibrio sp. HL-EbGR7 ACTTCCCAATTCCCAATTCCCACTTCTCACTTCCG
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF... 3070593-3071294	Sequence	Tgr7_2930 - hydrolase (Protein is coded in complementary strand; from 3071294 to 3070593)