Sequence retrieval

Genome: Thioalkalivibrio sp. HL-EbGR7
Start position: 3025068
End position: 3025102
Length: 35

DNA sequence
>NC_011901, from 3025068 to 3025102 (35 bp); Thioalkalivibrio sp. HL-EbGR7 GATTCAAAATTCAAAATTCAAGATTCAAAATTCAA
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF.. 3024180-3025070	Sequence	Tgr7_2886 - phosphoribosylaminoimidazole-succinocarboxamide synthase