Sequence retrieval

Genome: Thioalkalivibrio sp. HL-EbGR7
Start position: 3022275
End position: 3022302
Length: 28

DNA sequence
>NC_011901, from 3022275 to 3022302 (28 bp); Thioalkalivibrio sp. HL-EbGR7 AATTCAAAATTCAAGATTCAACATTCAA
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF.. 3021688-3022275	Sequence	Tgr7_2883 - methyltransferase small (Protein is coded in complementary strand; from 3022275 to 3021688)