Sequence retrieval

Genome: Thioalkalivibrio sp. HL-EbGR7
Start position: 2938781
End position: 2938804
Length: 24

DNA sequence
>NC_011901, from 2938781 to 2938804 (24 bp); Thioalkalivibrio sp. HL-EbGR7 GAACAGGGACAGGAACACGAACAC
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 2938062-2939297	Sequence	Tgr7_2800 - Bcr/CflA subfamily drug resistance transporter (Protein is coded in complementary strand; from 2939297 to 2938062)