Sequence retrieval

Genome: Thioalkalivibrio sp. HL-EbGR7
Start position: 289912
End position: 289935
Length: 24

DNA sequence
>NC_011901, from 289912 to 289935 (24 bp); Thioalkalivibrio sp. HL-EbGR7 AGGTCCAGGTCGAAGTCCAGGTGC
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 289507-291267	Sequence	Tgr7_0263 argS arginyl-tRNA synthetase (Protein is coded in complementary strand; from 291267 to 289507)