Sequence retrieval

Genome: Thioalkalivibrio sp. HL-EbGR7
Start position: 2892302
End position: 2892325
Length: 24

DNA sequence
>NC_011901, from 2892302 to 2892325 (24 bp); Thioalkalivibrio sp. HL-EbGR7 GGTCGTGGTGGTGGTCGTGGGCGT
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 2892256-2893053	Sequence	Tgr7_2750 - high-affinity zinc uptake system ATP-binding protein ZnuC (Protein is coded in complementary strand; from 2893053 to 2892256)