Sequence retrieval

Genome: Thioalkalivibrio sp. HL-EbGR7
Start position: 2785970
End position: 2785993
Length: 24

DNA sequence
>NC_011901, from 2785970 to 2785993 (24 bp); Thioalkalivibrio sp. HL-EbGR7 CGGCATGGGCATCGGCATCGGCAT
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 2785713-2786180	Sequence	Tgr7_2645 - hypothetical protein (Protein is coded in complementary strand; from 2786180 to 2785713)